Table of Contents

HK J Paediatr (New Series)
Vol 26. No. 2, 2021

HK J Paediatr (New Series) 2021;26:75-87

Original Article

Comprehensive Mutation Analysis of the RAS/RAF/MEK/ERK Pathway in Paediatric Leukaemia and Significant Inferences

DF Akin-Bali, SH Aktas, A Ozcan, E Yilmaz, F Aydin, V Gök, E Ünal, M Karakükçü


Abstract

Objectives: Leukaemia is the most common cancer among paediatric population accounting for about 30% of paediatric cancer. As it's known, germ line mutations increase the risk of development of haematopoietic malignancy in childhood and deregulation of the Rat Sarcoma Viral Proto-Oncogene/Raf-1 Proto-Oncogene/Mitogen-Activated Protein Kinases/Extracellular Regulated Kinases (RAS/RAF/MEK/ERK) pathway is often caused by somatic mutations in the genes coding proteins of KRAS, NRAS, FLT3, PTPN11 and BRAF. However, mutations in this pathway in paediatric Acute Lymphoblastic Leukaemia (ALL) have not been thoroughly investigated, yet. Methods: Specific exons of 7 significant genes which were frequently mutated in the RAS/RAF/MEK/ERK pathway were determined inclusively by DNA sequence analysis in 27 children with leukaemia. PolyPhen-2 and SNAP tools were used to verify and estimate the determined changes. Also, evolutionary conservation analysis was performed. Results: Seven changes out of 22 changes were identified for the first time in this study. ERK2 p.P319S (18.5%) mutation and KRAS splice site mutation (3.7%) were predicted to be pathogenic. ERK2 p.P319S mutations was found to be pathogenic and at the critical point on the aminoacid which is evalutionary conserved. Although the frequency of mutations in ERK2 is very low in cancers (0.88%), the frequency of ERK2 p.P319S missense change was detected in our study at a significant rate such as 18.5%. Conclusion: There is limited knowledge about ERK inhibitors in leukaemia. The low frequency of ERK gene compared to KRAS and NRAS genes does not make ERK mutations less important. Our findings indicate the importance of this pathway mutations in paediatric ALL and associated with high risk leukaemia group characteristics. Hence, it can be evaluated as a signalisation pathway to target pharmacologically.

Keyword : ALL; Mutation; Paediatric leukaemia; RAS/RAF/MEK/ERK pathway


Introduction

Leukaemia is polygenic, multifactorial, complex, and heterogeneous disease as other cancer types.1-4 Especially, significant progress has been made in understanding the genetic background of paediatric leukaemia in recent years. As a result of genome-wide profilling studies, a considerable number of commonly mutated cellular pathway were identified; which were involved in lymphoid and myeloid lineages, tumour suppression, cytokine receptor kinase and Rat Sarcoma Viral Proto-Oncogene (RAS) signaling, and chromatin remodeling in leukaemia.1,5-9 The identified genetic anomalies in cellular pathways and molecular changes offer opportunities to find efficient modes of treatment acting on established abnormal mechanisms. Thus, chemotherapy-resistant leukaemias and recurrent leukaemias could be cured. However, the incidence of recurrent leukaemia is still high, especially, in moderate and high-risk patients despite intensive chemotherapy regimens.10,11 Thus, finding out novel targeted approaches are extremely important and necessary.

As it known, the Rat Sarcoma Viral Proto-Oncogene/Raf-1 Proto-Oncogene/Mitogen-Activated Protein Kinases/Extracellular Regulated Kinases (RAS/RAF/MEK/ERK) pathway is mutated in 30% of all cancer types. Therefore, the RAS/RAF/MEK/ERK pathway has become the center of scientific research to clarify its role in cancer pathogenesis and to investigate its potential to be targeted by pharmacological agents.9-15 It is known that chemotherapeutic agents used in leukaemia generally activate the RAS/RAF/MEK/ERK pathway.14,15

Thus, the deregulation of the RAS/RAF/MEK/ERK pathway; which includes point mutations, gene deletions, and chromosomal translocations in a vast array of gene types, has become a common subject matter in paediatric leukaemia, highlighting its significance in the development of the disease. The present study has aimed to examine the possible pathogenic mutations in the genes of the RAS/RAF/MEK/ERK pathway in 27 paediatric Acute Lymphoblastic Leukaemia (ALL) patients. Our study presents important data by analysing important hot spot regions of specific genes involved in the RAS/RAF/MEK/ERK pathway both on our study patients and the genes of paediatric leukaemia patient groups reported in the literature, combining two sets of information in one study.

Material and Methods

Subjects

The study population consisted of 27 patients aged between 1-15 years who were admitted to Erciyes University, Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology with the diagnosis of paediatric ALL (25 B-ALL and 2 T-ALL). The study is carried out in accordance with the code of Ethics of the World Medical Association for experiments involving humans. The study protocol was approved by Erciyes University School of Medicine Ethics Committee (Project No: 2018/53). A written informed consent was provided by the patient's parents. Patients were treated according to the Berlin-Frankfurt-Münster (BFM) 95 and ALL-IC-BFM 2002 protocols. Diagnostic blood samples were included in the study. Patients were classified as standard, moderate and high according to the prognostic risk classification. This classification is made according to the clinical characteristics of the patients at the time of diagnosis. Demographic, clinical and genetic data regarding the patient group included in the study are summarised in Table 1.

Sample Collection, DNA Isolation and Mutation Screening

Blood samples from patients included in the study were collected in 5 ml Ethylenediaminetetraacetic acid (EDTA)-tubes for DNA isolation. DNA isolation was performed for mutational analysis using the Thermo Scientific GeneJET Genomic DNA Purification Kit. The coding regions of selected genes were amplified by PCR. Primer sequences were listed in Table 2. After amplification, PCR products were sequenced using the ABI 3500 XL DNA Sequencer. Data was analysed using Data Collection Software and Chromas 2.6.5 (Technelysium) to determine sequence changes in comparison to reference MEK1, MEK2, BRAF, ERK1, ERK2, KRAS and NRAS sequences from Ensembl genome browser.

Cytogenetic Analysis

Bone marrow samples were collected with Heparin-containing tubes, and chromosome analysis was performed using G-banding. FISH was performed using dual-colour/dual-fusion probes for translocations of t(12;21), t(9;22) and t(4;11) according to the manufacturer's protocol provided by Cytocell, UK. Image capture was performed using Nikon Eclipse 80i equipped with a CCD-camera, appropriate filters and software.

In Silico Analysis of RAS/RAF/MEK/ERK Pathway Mutations

Polymorphism Phenotyping v2 (PolyPhen-2) calculates the functional description of Single Nucleotide Polymorphisms (SNPs), maps coding SNPs to gene transcripts, extracts protein sequence annotations and structural characteristics and constructs conservation profiles.16 The program estimates the probability of the missense mutation being damaging based on a combination of all these features and provides both a qualitative prediction (probably damaging, possibly damaging, benign or unknown) with a score (http://genetics.bwh.harvard.edu/pph2/).17

Screening for Non-Acceptable Polymorphisms (SNAP) is a machine learning device called "neural network". It distinguishes between effect and neutral variants/non-synonymous SNPs by taking a variety of sequence and variant features into account. The most important single feature for SNAP prediction is conservation in a family of related proteins as reflected by position-specific independent counts scores (https://www.rostlab.org/services/snap/).18

Evolutionary conservation analyses of the detected mutant amino acids were evaluated among different species (Homo sapiens to Xenopus tropicalis) via "Multiple sequence alignment" tool in the PolyPhen-2 software. Finally, softwares have the online access as Cancer-specific High-throughput Annotation of Somatic Mutations 3-1 (CHASM 3-1) and Variant Effect Scoring Tool (VEST) were used to estimate and verify the pathogenic effect of the detected changes.19,20

Accession numbers of detected mutations in our study was taken from Catalogue of Somatic Mutations in Cancer (COSMIC) (https://cancer.sanger.ac.uk/cosmic), Human Gene Mutation Database (HGMD) (http://www.hgmd.cf.ac.uk/ac/index.php).21,22 In addition, detected mutations in our study were compared with cBio bioinformatic analysis programme.23 Briefly, releated cancer type is chosen from web interface to investigate the target genes of our study inclusively in paediatric ALL patients from the presented data on the portal. The chosen The Cancer Genome Atlas (TCGA) data set consist of genome sequence data of 3003 paediatric ALL patients. The features of detected mutations were carried out comprehensively by using Oncoprint and mutation tools.

Statistics Analysis

Statistical analyses were generally performed at the DNA level. Statistical analysis was performed using "IBM SPSS Statistics 20 for Chi-Square". Genotype distribution was analysed for Hardy-Weinberg expectations by using X2 and Fisher's exact tests.

Table 1 Demographic, clinical and genetic data of paediatric ALL patients
ID Sex Diagnosis Age BM blast (%) WBC Risk group Treatment Status Out come Survival (Month) GIS toxicity Hepato-toxicity Cytogenetics molecular abnormalities Other disease Mutations carried by the patient
P-1 M B-ALL 16 90 286000 IR ALLIC-BFM 2009 Remission Alive 5 - Yes - Obesity C-6, C-8, C-10, C-13, C-15, C-16, C-20, C-22
P-2 F B-ALL 6 88 40680 IR ALLIC-BFM 2009 Exitus during treatment Exitus 2 - - - - C-2, C-5, C-7, C-11
P-3 F B-ALL 1 90 25800 HR ALLIC-BFM 2009 Remission Alive 7 - - t (12;21) - C-2, C-5, C-10, C-14
P-4 M B-ALL 2 95 22580 IR ALLIC-BFM 2009 Remission Alive 43 - - - - C-1, C-4, C-19, C-15
P-5 M B-ALL 9 47,5 222000 HR ALLIC-BFM 2009 Remission Alive 13 Yes - - - C-1, C-3, C-4, C-5, C-15, C-18, C-22
P-6 M B-ALL 2 UNK 60410 HR ALLIC-BFM 2009/
Rel-BFM 2016
Relaps Alive 28 - - - - C-8
P-7 M B-ALL 3 80 9330 LR ALLIC-BFM 2009 Remission Alive 18 - - t (12;21) - -
P-8 F B-ALL 1 75 82000 HR ALLIC-BFM 2009 Remission Alive 8 - - t (4;11) Biotinidase deficiency C-7, C-11
P-9 F B-ALL 3 40 6960 IR ALLIC-BFM 2009 Remission Alive 8 - Yes - - C-7, C-8, C-12, C-13, C-14
P-10 F B-ALL 3 85 114980 IR ALLIC-BFM 2009 Remission Alive 43 - - - - C-13, C-22
P-11 M B-ALL 5 40 6740 IR ALLIC-BFM 2009 Remission Alive 7 - - - - C-9, C-18, C-21
P-12 F B-ALL 12 80 83370 IR ALLIC-BFM 2009 Remission Alive 6 - - - - C-9, C-18, C-21
P-13 M T-ALL 13 UNK 394000 HR ALLIC-BFM 2009 Remission Alive 14 Yes Yes - - C-13, C-14
P-14 M B-ALL 6 50 5330 IR ALLIC-BFM 2009 Remission Alive 7 - Yes - - C-1, C-22
P-15 M B-ALL 4 82 8280 IR ALLIC-BFM 2009 Remission Alive 13 - Yes t (12;21)   C-9, C-22
P-16 M B-ALL 3 80 103060 IR ALLIC-BFM 2009 Remission Alive 7 - Yes Ts21 Down syndrome C-2, C-7
P-17 F B-ALL 8 UNK UNK IR ALL-BFM 95 Remission Alive 192 - - - - C-1, C-3, C-4, C-5, C-22
P-18 F B-ALL 4 80 7980 IR ALLIC-BFM 2009 Remission Alive 46 Yes Yes PTPN11/
NM_001
330437/EXON 4
variant: C.417G>C
P.(GLU139 Asp missense mutation/ Heterozygote
Noonan sendromu C-2, C-7, C-22
P-19 M B-ALL 13 78 7470 IR ALLIC-BFM 2009 Remission Alive 8 - - - - C-1, C-2, C-7, C-19, C-15
P-20 M B-ALL 5 50 10540 IR ALLIC-BFM 2009 Remission Alive 7 - - - - C-2, C-9, C-22
P-21 F B-ALL 2 92,4 940000 HR ALLIC-BFM 2009 Refractory Alive 16 - - t (4;11) - C-4, C-5, C-9, C-22
P-22 M B-ALL 14 45 9680 HR ALLIC-BFM 2009 Remission Alive 6 - - - - C-9
P-23 F B-ALL 2 85 6280 IR ALLIC-BFM 2009 Remission Alive 16 - - - - -
P-24 M T-ALL 1 50 110000 HR ALLIC-BFM 2009 Remission Alive 38 - - - - C-2, C-4, C-5, C-17
P-25 M B-ALL 4 79,7 7470 IR ALLIC-BFM 2009 Remission Alive 18 - - - - C-2, C-7, C-22
P-26 M B-ALL 4 92 18230 IR ALLIC-BFM 2009 Remission Alive 31 - - - - C-9, C-18
P-27 F B-ALL 12 80 44000 IR ALLIC-BFM 2009 Remission Alive 5 - - - - C-4, C-5, C-7, C-17, C-22
M: male; F: female; WBC: white blood cell; ALL:acute lymphoblastic leukaemia; HR: high risk; IR: intermediate risk; LR: low risk; ALLIC-BFM 2009: acute lymphoblastic leukaemia Berlin Franfurt Munster; t: translocation; BMT: bone marrow transplantation; UNK: unknown,

Results

Demographic and Clinical Analysis of Paediatric ALL Patient Groups

The study population consisted of 27 patients (11 girls and 16 boys) aged between 1 and 15 years (mean age 6 years) who were diagnosed with paediatric ALL. The distribution was as follows; 25 of 27 paediatric leukaemia patient was B-ALL and 2 of 27 was T-ALL.

Briefly, three patients were determined as t(12;21) carrier while one patient was t(4;11) carrier according to cytogenetic analysis. One patient has p.G139N missense mutation on PTPN11 gene called Nooan Syndrome and 1 case has the Down syndrome. It was observed that one case relapsed during the treatment period and one case died.

According to risk classification, 8 cases has been identified as high risk, 18 cases as medium risk and 1 case as low risk. When treatment protocols examined, 26 cases received ALLIC-BFM 2009 and 1 case received ALL-BFM 95 treatment.

Results of Mutation Analysis

Since it was not possible to obtain germline tissue from patients, mutation analysis carried out with somatic tissues. Mutation detection from the blood samples of 27 patients was carried out by DNA analysis system. As a result of mutation analysis performed from seven genes in the RAS/RAF/MEK/ERK pathway 22 changes (3 missense, 2 silent mutations, 1 splice site mutation, 16 SNPs) were detected. Sixteen of these changes were previously recorded in the HGMD and 7 were novel. All detected mutations had heterozygote genotype. Changes were observed in 25 (92.5%) of 27 patients. Nucleotide changes in the pathway were shown in the electrofrograms given in Figure 1. Schematic representation of domain architecture of the 7 mutations found in RAS/RAF/MEK/ERK pathway in paediatric ALL were shown in Figures 2 and 3. Detected genetic changes were given in detail in Table 3.

Figure 1 The sequencing electropherograms of MEK1, MEK2, BRAF, ERK1, ERK2, KRAS and NRAS genes mutations and variants. The arrow shows to localisations of the mutation and variant (A-G).

Figure 2 Schematic representation of domain architecture of the MEK2, MEK1, NRAS and KRAS proteins and mutations found in paediatric ALL (A-B) Linear representation of the key functional domains of the human MEK1 and MEK2 proteins. Human MEK1 and MEK2 encode protein kinases of 400 amino acids (C) Human NRAS is a polypeptide of 189 amino acids (D) Human KRAS is polypeptide of 189 amino acids. DD, Docking domain; NES, nuclear export sequence; NRR, Negative regulatory region; PRD, Proline-rich domain; DVD MAP kinase kinase kinase (MAP3K) docking domain.

Figure 3 Schematic representation of domain architecture of the ERK1, ERK2 and BRAF proteins and mutations found in paediatric ALL (A) Human ERK2 is polypeptide of 360 amino acids and (B) ERK1 is polypeptide of 379 amino acids (C) Human BRAF is polypeptide of 765 amino acids. GRL, glycine rich domain; HR, hinge region; AS, activation segment; KID, kinase insert domain; CDC; common docking domain; AL, activation loop; CL, catalytic loop; CR, conserved region; CRD, cysteine-rich domain; KD, kinase domain; P-L, phosphatebinding loop; RBD, RAS-binding domain.

Table 2 The primer sequences and amplicon lengths for KRAS, NRAS, BRAF MEK1, MEK2, BRAF, ERK1 and ERK2 genes
Gene/Exon Forward Primer (5'-3') Reverse Primer (5'-3') Amplicon(bp)
KRAS CTGCTGAAAATGACTGAATA ATGGTCCTGCACCAGTAATA 162
KRAS CCAGACTGTGTTTCTCCCTTC AAAGAAAGCCCTCCCCAGT 132
NRAS GACTGAGTACAAACTGGTGGTGG GGGCCTCACCTCTATGGTG 118
NRAS CAAGTGGTTATAGATGGTGAAACC AAGATCATCCTTTCAGAGAAAATAAT 231
BRAF (exon 11) AGTAAGGGGATCTCTTCCTGTATCC TGCTGTGAACAGTTTTTATTTCC 416
BRAF (exon 15) GGAAAGCATCTCACCTCATCC TGGTTTCAAAATATTCGTTTTAAGG 566
MEK1 (exon 3) CCTCTCTAGCCTCCCACTTTG CAAACAGCACAAAAAGGTATTGA 452
MEK1 (exon 4) CCTGTTTCTCCTCCCTCTACC ACACCCACCAGGAATACTGC 494
MEK2 (exon 4) AGGCAGAACTGTCAGAAGACG CTTGGCCACTCTCTTTCTGC 381
MEK2 (exon 5-6) CAGCACTGTCTCGTCTCTGG CTTAAGGGTGAAATATTCTC 580
ERK1 CTGCTCTCACTACTGCAAAACC TGGCAGCAGGTATATCTCAGG 246
ERK2 CTGACTCCTGCCCTTCCATA GGGTGGTAGAGACAGCAAGG 231
Note: Approximately, 200 ng of DNA was used as template for PCR amplification. Total volume of reaction mix was 25 μL, which comprised of 16,75 μL sterile water, 2.5 μL reaction buffer (750 mM Tris-HCl pH 8.8 at 25°C, 200 mM (NH4)2SO4, 1 μL dNTP mix (A, C, G, T 200 mM), 1.25 μL MgCl2 (25 mM), 1 μL forward and reverse primers (10 pmol), 0.5 μL Taq polymerase (500 U, Fermentas) and 1 μL template DNA (at least 500 ng/μL for each sample). Amplification reactions were performed using Applied Biosystems Veriti VR 96-Well Thermal Cycler and started with an initial denaturation step at 94 C for 5 min, followed by 40 cycles of denaturation for 45 s at 94 C, primer annealing for 1.5 min at 58 C, extension for 1.5 min at 72 C and final extension for 10 min at 72 C.

RAS Analysis

NRAS changes were detected in 3 (11.1%) of 27 patient group. KRAS changes were detected in 12 (44.4%) of 27 patient group. The missense mutation, p.H95N, on the GTP binding domain and splice site mutation, c.-11G>A, on the 5'UTR of KRAS were previously recorded in the HGMD and found related with colon carcinoma pathogenesis. Only one patient (P-1) carrying this mutation (c.-11G>A) was detected.

BRAF Analysis

c.530+47G>A nucleotide change on the intron region in the BRAF was detected in 10 (37%) of 27 patients.

MEK Analysis

While MEK2 was the most altered gene (17 patients), NRAS was the least altered gene (3 patients) among investigated genes. Among these changes 5 SNP were detected in MEK2 and four of them were novel. SNPs in MEK1 were detected in 8 patients. They were found on the noncoding domain and determined as benign. p.D151D silent mutation was detected in 5 patients (P-4, P-5, P-14, P-17, P-19) on the kinase domain of MEK2 and previously recorded in the HGMD.

ERK Analysis

p.P328S mutation in ERK1 was recorded in HGMD as missense mutation and detected in patient 1 (P-1) in our study group. p.P336P mutation in ERK1 was recorded in HGMD as silent mutation and detected in patient 12 (P-12) in our study group. c.886-29 G>A SNP in ERK1 gene was detected in 2 of 27 patients (7.4%) and was novel (Table 3, C18). p.P319S missense mutation on the Comming Docking Domain (CDC) of ERK2 was recorded to COSMIC database with the reference number COSV54736383 .This mutation was detected 5 of 27 patients (18.5%) (Table 3, C13). Besides, 3 SNPs were detected for the first time in this study which carries this mutation in ERK2 (Table 3, C14, C15 and C16).

Results of Mutation Profile of Patients with Relapse

The mutation profiles of relaps patient (P-6) and refractory leukaemia patient (P-21) evaluated separately. A noncoding change, NRAS c.111+62 C>A, which is in the regulator domain of relaps patient (P-6) was examined. Besides, refractory leukaemia patient (P-21) has changes in 3 different genes: 2 MEK2 intronic change, 1 NRAS regulator domain change and BRAF intronic variant. All two patient have in the category of high risk group.

Results of in Silico Analysis of RAS/RAF/MEK/ERK Pathway Mutations

According to PolyPhen2 and SNAP automatic tools for prediction of the possible impact of the mutations to the protein function, the data obtained as follows: NRAS p.G12A and ERK2 p.P319S missense mutations might be pathogenic because of the fact that their scores were close to 1 in the PolyPhen-2 analysis. NRAS p.G12A, KRAS p.H95N and ERK2 p.P319S mutations were found effected in SNAP software (Table 3).

Amino acid sequences of detected mutations were compared among conserved amino acids of Homo Sapiens to Xenopus tropicalis during the evolutionary process by "Multiple sequence alignment" tool in the PolyPhen2. In conclusion, NRAS p.G12A, ERK1 p.P328S and ERK2 p.P319S missense mutations were found to change the amino acids which were at a critical point among conserved species mentioned above. In addition, according to the analysis performed from the TGCA data set of paediatric leukaemia group in the cBio database, NRAS was found the mostly mutated gene (5%) while ERK1 was found the least mutated gene (0.4%). KRAS and NRAS carries nucleotide change mutations while other genes only carry gene amplifications and deletions. Four mutations in the KRAS (p.G12D, p.G13D, p.Q61H ve p.K117N) and 3 mutations in the NRAS (p.G12D, p.G13D ve p.Q61L/K/R) were attention getting (Table 3).

Table 3 Mutations of the RAS/RAF/MAPK/ERK pathway in patients with paediatric ALL
No Gene Nt alteration Accession number Alteration type Localisation AA position Number of patients carriying changes Previously determined tumour type Poly-Phen2 CHASM VEST
C-1 MEK2 c.453 C>T rs
17851657
Silent mutation Kinase catalytic domain p.D151D P-4, P-5, P-14, P-17, P-19 1000 Genome Project Benign
(non-patogenic)
Neutral Neutral
C-2 MEK2 c.528+101
T>G
Novel SNP Noncoding NA P-2, P-3, P-16, P-18, P-20, P-23, P-24 Present Study UNK UNK UNK
C-3 MEK2 c.528+117
A>G
Novel SNP Noncoding NA P-5, P-17 Present Study UNK UNK UNK
C-4 MEK2 c.528+102
A>C
Novel SNP Noncoding region(intronic) NA P-4, P-5, P-17, Present Study UNK UNK UNK
C-5 MEK2 c.528+98_
528+99del
rs SNP Intron variant NA P-2, P-3, P-5, P-17, P-24 NIH Project UNK UNK UNK
C-6 MEK2 c.528+18 C>A Novel SNP Intron variant NA P-1 Present Study UNK UNK UNK
C-7 MEK1 c.291+22 G>C rs
16949924
SNP Intron variant NA P-2, P-8, P-9, P-16, P-18, P-19, P-25, P-27 1000 Genome Benign
(non-patogenic)
Neutral Neutral
C-8 NRAS c.111+62
C>A
Novel SNP Noncoding regulatory variant NA P-1, P-6, P-9 Present Study UNK UNK UNK
C-9 KRAS c.111+21
C>G
rs
75099787
SNP Intron variant NA P-3, P-4, P-12, P-15, P-19, P-20, P-21, P-22, P-26 1000 Genome Project UNK UNK UNK
C-10 KRAS c.11 G>A COSM
6438043
5 prime UTR variant Splice region variant - P-1 Colon carcinoma Pathogenic (score 0.96) UNK UNK
C-11 KRAS c.111+20 G>A rs
534412138
SNP Noncoding region(intronic) NA P-2, P-8, P-11 1000 Genome Project Benign
(non-patogenic)
Neutral Neutral
C-12 KRAS c.283 C>A rs
1309399018
Missense variant GTP binding domain p.H95N P-9 GNOMAD Benign
(non-patogenic)
Neutral Neutral
C-13 ERK2 c.955 C>T COSV
54736383
Missense mutation Kinase domain p.P319S P-1, P-3, P-9, P-10, P-13 Skin tumour Pathogenic (score 0.8) Effected (score 0,0244) Effected (score 0,0841)
C-14 ERK2 c.966+93 C>T rs
551863629
SNP Noncoding region(intronic) NA P-9, P-13 1000 Genome Project UNK UNK UNK
C-15 ERK2 c.96T>G6+79 Novel SNP Noncoding region(intronic) NA P-1, P-4, P-5, Present Study UNK UNK UNK
C-16 ERK2 c.966+71 C>T rs
917625448
SNP Noncoding region(intronic) NA P-1, P-4 1000 Genome Project UNK UNK UNK
C-17 ERK1 c.886-16 G>T rs
369133216
SNP Noncoding variant NA P-24, P-27 NHLBI Exome Sequencing Project Benign
(non-patogenic)
Neutral Neutral
C-18 ERK1 c.886-29 G>A Novel SNP Noncoding region(intronic) NA P-5, P-12 Present Study UNK UNK UNK
C-19 ERK1 c.1018-37 A>G rs
1187865979
SNP Noncoding transcript exon variant NA P-26 1000 Genome Project Benign
(non-patogenic)
Neutral Neutral
C-20 ERK1 c.982 C>T rs
1167791407
Missense variant Kinase domain p.P328S P-1 GNOMAD Benign
(non-patogenic)
Effected (scores 0,8782) Effected ( scores 0,0544)
C-21 ERK1 c.1008 G>A rs
1143695
Silent mutation Noncoding transcript variant(3'UTR) p.P336P P-12 GNOMAD Benign
(non-patogenic)
Neutral Neutral
C-22 BRAF c.530+47 G>A rs
1420870304
SNP Intron variant NA P-1, P-5, P-10, P-14, P-15, P17-P18, P-20, P-21, P-27 NIH project UNK UNK UNK
UNK: unknown, NA: not available, SNP: single nucleotide polymorphism, AML: acute myleoid leukaemia, C: change, UTR: untranslated region

Discussion

The RAS/RAF/MEK/ERK pathway is an important pathway that plays a central role not only in the regulation of normal cellular processes related to proliferation, growth, and differentiation, but also in oncogenesis.14,24-27 Deregulation of this signaling pathway is common in various cancer types. Therefore, the RAS/RAF/MEK/ERK pathway appears as an attractive target for therapeutic inhibition. It has been shown in experimental studies that the therapeutic inhibition of the RAS/RAF/MEK/ERK pathway can be beneficial particularly in the treatment of high-risk leukaemias. Point mutations, gene deletions, and chromosomal translocations in GTPases, RTKs, phosphatases, and ubiquitin ligases in this pathway may also be involved in leukaemia pathogenesis.9-15,24-26

Molecular anomalies in the RAS/RAF/MEK/ERK pathway are involved in cell proliferation and survival independent from the effects of growth factors; resulting in transformation and disease progression.9-15,25,26 In the majority of cases, somatic mutations resulting in amino acid changes have been detected at the RAS codons 12, 13, and 61 that disrupt the GTPase activity of the protein. Consequently, mutant RAS proteins start to accumulate remaining in the GTP-bound form, leading to the development of resistance to GTPase-activating proteins.27,28

While whole-spectrum changes at the codon 12 (glycine) cause cell transformation particularly, different mutations have been found out to affect cell morphologies differently.13-15,24,25 The incidence of RAS pathway mutations is high in Acute Lymphoblastic Leukaemia (ALL). RAS pathway mutations occur at a high rate in individuals with high hyperdiploidy. Also, it has been reported that the frequency of RAS pathway mutations is similar in the individuals with "high-risk" hypodiploid ALL.29 It has been reported that the frequency and features of the RAS pathway mutations can be significant in relapsed ALL.10,17,30

In this study, genotyping has been performed by DNA sequencing analysis to detect mutations/SNPs in 7 genes of the RAS/RAF/MEK/ERK pathway of 27 paediatric ALL patients. Our study results revealed mutations (3 missense mutations, 2 silent mutations, 1 splice site mutation, and 16 SNPs) in 23 out of 27 patients. While 16 of these mutations were previously recorded in HGMD, 7 have been found out to be new.

It is known that the frequency of RAS mutations is higher in relapsed leukaemias compared to newly diagnosed leukaemias. One relapse patient and one refractory leukaemia patient; totally 2 resistant patients, in our study group carry KRAS and NRAS variants. Patients with NRAS/KRAS mutations, especially the patients carrying KRAS variants, are likely to develop resistance to treatment regimens, ending in a reduced cytological remission rate and reduced overall survival. When the clinical and hematological features of the 27 patients were compared by the carrier status of the RAS/RAF/MEK/ERK pathway mutations, a significant correlation was found between being a carrier of KRAS mutations and being in the high-risk group (p=0.03). Another finding of our study is the identification of the c.11G>A (COSM6438043) splice site mutation in the KRAS gene in the paediatric B-ALL patients that constituted our study population. However, the c.11G>A (COSM6438043) splice site mutation in the KRAS gene was previously detected in colon cancer. This finding suggests that the splice site is likely to cause a deficiency in KRAS expression since it is 100% protected across species in the evolutionary process and the mutation occurs on the first base of the splice zone. As revealed by many studies; RAS proteins, which are very similar and protected across different cells types, play an indirect role in cell cycle control as well as mitogenic effect.12,13,27,30 RAS proteins, which are inactive when they are GDP-bound, are activated by the separation of GDP and binding of GTP. Activating (functioning) mutations cause GTP to remain bound to RAS. As a result, the RAS-MAPK pathway remains open and the resulting abnormal expression leads to signal generation for uncontrolled cell division and cancer eventually. Most studies on human tumours found out that the RAS codons 12, 13, and 61 were the frequently mutated oncogenic mutation sites.24, 27,30 In one patient in our study population, the amino acid change from Glycine to Alanine (p. G12A) was detected at codon 12, which is a predictive biomarker on NRAS exon 1 for colorectal cancer. It has been reported in the literature that the mutation of glycine to any amino acid other than proline at codon 12 causes unexpected activation of RAS. Mutations at codon 12 act involving the catalytic Arginine and block the GTP-GDP conversion.31,32 Furthermore, the analyses on the TGCA paediatric leukaemia data set reveals that the mutations detected in NRAS and KRAS are putative drivers and possibly a homozygous deletion occurs in the studied genes, acting on gene expression.

The BRAFV600E mutation, which causes a significant increase in kinase activity, is frequently seen in other types of malignancies and promotes continuous transcription-mediated proliferation that supports neoplastic growth.14,24,26,31 However, this value was found statistically significantly different between the patients diagnosed over the age of 10 and the patients of the 1-10-year age group having similar demographic characteristics and BRAF mutations. The eighty percent of MEK proteins, which are members of the STE kinase family, show sequence homology among themselves. Of MEK proteins, which are members of the STE kinase family, 80% show sequence homology among themselves. As a result of phosphorylation of MEK1/2 kinases from threonine and tyrosine residues at the kinase catalytic domain, ERK1/2 phosphorylation occurs. MEK1 shows genetic anomalies in all cancers at a rate of 1.01% and the most common genetic anomaly is seen in malignant melanoma.33

ERK1/2 is involved in vital events for cell physiology such as cell proliferation, differentiation, transcriptional regulation, and cellular development. ERK2 mutations are frequently seen in the cervix, endometrium, and skin cancers. The frequency of mutations in ERK2 is very low in human cancers (0.88%). The incidence of ERK2 p.P319S missense mutation; which is considered pathogenic, especially for malignant melanoma, was determined to be 16.6% in our study. The ERK2 p.P319S missense mutation occurs at the binding point of a protein that acts as a negative regulator in various processes, including cell differentiation and proliferation that are controlled by the RAS/ERK pathway known as MKP3.34 MEK1/2, which is at a higher stage in the signaling cascade, can randomly phosphorylate ERK1 and ERK2 on the same amino acid sequence.35,36

All substrates to be bound to ERK1/2 are bound at the site known as the CDC domain. The ERK2 p.P319S missense mutation detected in our study is on the CDC domain. The ERK signaling pathway specifically controls various cellular processes including proliferation and survival. Therefore, ERK1/2 plays a critical role in the development of uncontrolled cell proliferation-related diseases such as cancer. The cellular outcomes of common docking site mutations have not been established. Also, their potential to cause treatment-resistant tumours is still unknown. On the other hand, the study reported by Weisberg E, et al in 2019 has an important point that matches the results of our current study.37 Weisberg E et al. carried out in-vitro and in-vivo experiments on the ERK1/2 inhibitor LY3214996, which is currently being studied in clinical trials (NCT02857270). Weisberg E, et al reported that ERK can be considered a therapeutic target in acute myelogenous leukaemia. There are some important points indicating the importance of ERK mutations: (i) The frequency of ERK2 p.P319S missense mutation has been detected in our study at a significant rate; which is 16.6%, (ii) As Weisberg E, et al. reported, only some ERK inhibitors were clinically tested in solid tumours indicating that there is limited knowledge about ERK inhibitors in leukaemia. However, the types of leukaemia investigated in our study and the study by Weisberg E et al. are different. Our study included ALL patients but Weisberg E et al. evaluated ERK inhibitors in AML. As can be seen in Figure 4A, the frequency of KRAS and NRAS mutations are higher in paediatric leukaemia. However, the most amplified genes are MEK2 and ERK2. As it is known, gene amplification causes uncontrolled and excessive gene expression and drug resistance, indicating that the low frequency of ERK gene compared to KRAS and NRAS genes should not lead to the underestimation of the role of ERK mutations. Therefore; the role of ERK genes in treatment needs to be evaluated, considering the most common gene amplifications.

In addition to the missense mutations we detected, synonymous mutations in MEK2 and ERK1 have been identified, which are registered in HGMD. MEK2 p. D151D (20%) and ERK1 p.P336P synonymous mutation were determined at a rate of 3% in our study population. In this study, important findings that have been reported for the first time in the literature have been revealed. Our study has revealed important findings that have been reported for the first time in the literature. Our study found a total of 22 mutations, 7 of which were defined for the first time. Although we demonstrated the RAS/RAF/MEK/ERK pathway mutations in the paediatric leukaemia patient group and studied the molecular characteristics in detail, further research is needed to clarify the epidemiology of genetic mutations responsible for the pathogenesis of paediatric leukaemia.

Our results emphasize that mutations that changing the function of the RAS/RAF/MEK/ERK pathway play an important role in paediatric ALL. Furthermore, the identification of mutations in the components of the signaling pathway can contribute significantly to determining the efficacy of the pharmacological agents used in the treatment of leukaemia and estimating the prognosis of the patient.

Figure 4 (A) Distribution of mutations in KRAS, NRAS, BRAF, MEK1(MAP2K1), MEK2(MAP2K2), ERK1(MAPK3) and ERK2(MAPK1) genes in patients with paediatric leukaemia from cBio Cancer Genomics Portal. (B) Schematic representation of domain architecture of the KRAS and NRAS proteins and mutations found in patients with paediatric leukaemia using in silico analysis from cBio Cancer Genomics Portal.

Conclusion

Leukaemia, the most common malignant disease of the childhood, is a large group of diseases of unknown aetiology. Moreover, recurrent leukaemia has a high incidence despite the availability of intense chemotherapy regimens. Recurrent leukaemia is treated with the same chemotherapeutics as the ones used in leukaemia at the time of initial diagnosis; however, resistance to the chemotherapeutic agents often develops. RAS pathway activation is common in ALL as well as AML. The uncontrolled activation of the RAS pathway results from point mutations, gene deletions, and chromosomal translocations in a wide variety of genes, coding GTPases, RTKs, phosphatases, and ubiquitinases. The importance of the uncontrolled activation of the RAS pathway in leukaemia biology is emphasized by the studies in the literature. Identification of anomalies at several stages of the pathway will make it possible to find out treatment options, thereby allowing for the treatment of chemotherapy-resistant and recurrent leukaemias and the development of personalised treatment methods.

Acknowledgments

We acknowledge the patients and staff who participated in our research studies.

Ethics Approval and Consent to Participate

This study was approved by the Ethics Committee of Erciyes University (Kayseri, Turkey). All participants provided written informed consent.

Patient Consent for Publication

Not applicable.

Declaration of Interest

The authors certify that they have no financial interest in the subject matter or materials discussed in this manuscript.

Funding

This work was supported by grants from the Scientific Research Projects of Nigde Omer Halisdemir University (BAP; Project no SSB 2018/11-BAGEP).

ORCID Numbers

Dilara Fatma Akin-Bali 0000-0002-0903-0017
Sedef Hande Aktas 0000-0002-1091-6974/
Alper Ozcan 0000-0002-6100-1205
Ebru Ylmaz 0000-0003-4802-0986
Firdevs Aydin 0000-0003-3126-1521
Veysel Gok 0000-0002-7195-2688
Ekrem Unal 0000-0002-2691-4826
Musa Karakukcu 0000-0003-2015-3541


References

1. Mullighan CG. The genomic landscape of acute lymphoblastic leukemia in children and young adults. Hematology Am Soc Hematol Educ Program 2014;1:174-80.

2. Mullighan CG, Downing JR. Genome-wide profiling of genetic alterations in acute lymphoblastic leukemia: recent insights and future directions. Leukemia 2009;23:1209-18.

3. Pui CH, Carroll WL, Meshinchi S, et al. Biology, risk stratification, and therapy of pediatric acute leukemias: an update. J Clin Oncol 2011;29:551-65.

4. Inaba H, Greaves M, Mullighan CG. Acute lymphoblastic leukaemia. Lancet 2013;38:1943-55.

5. Terwilliger T, Abdul-Hay M. Acute lymphoblastic leukemia: a comprehensive review and 2017 update. Blood Cancer 2017;7:e577.

6. Coccaro N, Anelli L, Zagaria A, Specchia, G. Albano, F. Next-Generation Sequencing in Acute Lymphoblastic Leukemia. Int J Mol Sci 2019;15:20.pii: E2929.

7. Zhang HH, Wang HS, Qian XW. Genetic variants and clinical significance of pediatric acute lymphoblastic leukemia. Ann Transl Med 2019;7:296.

8. Star?J, Zuna J, Zaliova M. New biological and genetic classification and therapeutically relevant categories in childhood B-cell precursor acute lymphoblastic leukemia. F1000Res 2018;7:F1000 Faculty Rev-1569.

9. Liang DC, Chen SH, Liu HC, et al. Mutational status of NRAS, KRAS, and PTPN11 genes is associated with genetic/cytogenetic features in children with B-precursor acute lymphoblastic leukemia. Pediatr Blood Cancer 2018;65.

10. Irving J, Matheson E, Minto L. Ras pathway mutations are prevalent in relapsed childhood acute lymphoblastic leukemia and confer sensitivity to MEK inhibition. Blood 2014;124:3420-30.

11. Oshima K, Khiabanian H, da Silva-Almeida AC, et al. Mutational landscape, clonal evolution patterns, and role of RAS mutations in relapsed acute lymphoblastic leukemia. Proc Natl Acad Sci USA 2016;113:11306-11.

12. Prior IA, Lewis PD, Mattos C. A comprehensive survey of Ras mutations in cancer. Cancer Res 2012;72:2457-67.

13. Liu X, Ye Q, Zhao XP, et al. RAS mutations in acute myeloid leukaemia patients: A review and meta-analysis. Clin Chim Acta 2019;489:254-60.

14. Chung E, Kondo M. Role of Ras/Raf/MEK/ERK signaling in physiological hematopoiesis and leukemia development. Immunol Res 2011;49:248-68.

15. Knight T, Irving JA. Ras/Raf/MEK/ERK Pathway Activation in Childhood Acute Lymphoblastic Leukemia and Its Therapeutic Targeting. Front Oncol 2014;4:160.

16. Adzhubei I, Jordan DM, Sunyaev SR. Predicting functional effect of human missense mutations using PolyPhen-2. Curr Protoc Hum Genet 2013;Chapter7:Unit7.20.

17. Walters-Sen LC, Hashimoto S, Thrush DL, et al. Variability in pathogenicity prediction programs: impact on clinical diagnostics. Mol Genet Genomic Med 2015;3:99-110.

18. Bromberg Y, Rost B. SNAP: predict effect of non-synonymous polymorphisms on function. Nucleic Acids Res 2007;35:3823-35.

19. Masica DL, Douville C, Tokheim C, et al. CRAVAT 4: Cancer-Related Analysis of Variants Toolkit. Cancer Res 2017;77:e35-8.

20. Douville C, Carter H, Kim R, et al. CRAVAT: cancer-related analysis of variants toolkit. Bioinformatics 2013;29:647-8.

21. Tate JG, Bamford S, Jubb HC, et al. COSMIC: the catalogue of somatic mutations in cancer. Nucleic Acids Res 2019;47:941-7.

22. Stenson PD, Mort M, Ball EV, et al. The Human Gene Mutation Database: towards a comprehensive repository of inherited mutation data for medical research, genetic diagnosis and next-generation sequencing studies. Hum Genet 2017:136;665-77.

23. Cerami E, Gao J, Dogrusoz U, et al. The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov 2012;2:401-4.

24. Giménez N, Martínez-Trillos A, Montraveta A, et al. Mutations in the RAS-BRAF-MAPK-ERK pathway define a specific subgroup of patients with adverse clinical features and provide new therapeutic options in chronic lymphocytic leukemia. Haematologica 2019;104:576-86.

25. Perentesis JP, Bhatia S, Boyle E, et al. RAS oncogene mutations and outcome of therapy for childhood acute lymphoblastic leukemia. Leukemia 2004;18:685-92.

26. Steelman LS, Franklin RA, Abrams SL, et al. Roles of the Ras/Raf/MEK/ERK pathway in leukemia therapy. Leukemia 2011;25:1080-94.

27. Degirmenci U, Wang M, Hu J. Targeting Aberrant RAS/RAF/MEK/ERK Signaling for Cancer Therapy. Cells 2020;9:198.

28. Zhou JD, Yao DM, Li XX, et al. KRAS overexpression independent of RAS mutations confers an adverse prognosis in cytogenetically normal acute myeloid leukemia. Oncotarget 2017;8:66087-97.

29. Wiemels JL, Kang M, Chang JS, et al. Backtracking RAS mutations in high hyperdiploid childhood acute lymphoblastic leukemia. Blood Cells Mol Dis 2010;45:186-91.

30. Case M, Matheson E, Minto L, et al. Mutation of genes affecting the RAS pathway is common in childhood acute lymphoblastic leukemia. Cancer Res 2008;68:6803-9.

31. Schubbert S, Shannon K, Bollag G. Hyperactive Ras in developmental disordersand cancer. Nat Rev Cancer 2007;7:295-308.

32. Vitagliano O, Addeo R, D'Angelo V, et al. The Bcl-2/Bax and Ras/Raf/MEK/ERK signaling pathways: implications in pediatric leukemia pathogenesis and new prospects for therapeutic approaches. Expert Rev Hematol 2013;6:587-97.

33. Estep AL, Palmer C, McCormick F, Rauen KA. Mutation analysis of BRAF, MEK1 and MEK2 in 15 ovarian cancer cell lines: implications for therapy. PLoS One 2007 5;2:e1279.

34. Liu S, Sun JP, Zhou B, Zhang ZY. Structural basis of docking interactions between ERK2 and MAP kinase phosphatase 3. Proc Natl Acad Sci USA 2006;103:5326-31.

35. Sammons RM, Perry NA, Li Y, et al. A Novel Class of Common Docking Domain Inhibitors That Prevent ERK2 Activation and Substrate Phosphorylation. ACS Chem Biol 2019;14:1183-94.

36. Cavallini C, Visco C, Putta S, et al. Integration of B-cell receptor-induced ERK1/2 phosphorylation and mutations of SF3B1 gene refines prognosis in treatment-naïve chronic lymphocytic leukemia. Haematologica 2017;102:144-7.

37. Weisberg E, Meng C, Case A, et al. Evaluation of ERK as a therapeutic target in acute myelogenous leukemia [published correction appears in Leukemia. Leukemia 2020;34:625-9.

 
 

©2026 Hong Kong Journal of Paediatrics. All rights reserved. Developed and maintained by Medcom.